8. Break the following DNA sequences into triplets. (Draw a line to separate the triplets)5’ - C C G A T A C G C G G T A T C C C A G G G C T A A T T G A A - 3’
Question
8. Break the following DNA sequences into triplets. (Draw a line to separate the triplets)
5’ - CCG | ATA | CGC | GGT | ATC | CCA | GGG | CTA | ATT | GAA - 3’
Solution
To break down the given DNA sequence into triplets, we can follow these steps:
1. Identify the Sequence
The original DNA sequence provided is: 5’ - CCGATACGCGGTATCCCGGGCTAATTGAA - 3’
2. Break into Triplets
We'll separate the sequence into groups of three nucleotides (triplets).
3. Write the Triplets
The triplets are as follows:
- CCG
- ATA
- CGC
- GGT
- ATC
- CCG
- GGC
- TAA
- TTG
- AA
4. Present the Triplets
We can represent the triplets with lines separating them:
5’ - CCG | ATA | CGC | GGT | ATC | CCG | GGC | TAA | TTG | AA - 3’
Final Answer
The triplets for the DNA sequence are: 5’ - CCG | ATA | CGC | GGT | ATC | CCG | GGC | TAA | TTG | AA - 3’
Similar Questions
8. Break the following DNA sequences into triplets. (Draw a line to separate the triplets)5’ - C C G A T A C G C G G T A T C C C A G G G C T A A T T G A A - 3’
Nucleotides are always added to the 3’ end of DNA.Group of answer choicesFalseTrueNext
The 3’ end of a DNA strand is the end with the _____.Group of answer choices-PO₄⁻²-OHNext
Question 3How many DNA strings transcribe and translate into the amino acid string LEADER?
How many nucleotides are there in 3 complete twists in the helix? A 15 B 20 C 10 D 30
Upgrade your grade with Knowee
Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.