StudyGPT Just Leveled Up – Say Hello to Knowee! 🚀
Knowee
Questions
Features
Study Tools

8. Break the following DNA sequences into triplets. (Draw a line to separate the triplets)5’ - C C G A T A C G C G G T A T C C C A G G G C T A A T T G A A - 3’

Question

🧐 Not the exact question you are looking for?Go ask a question

Solution

To break down the given DNA sequence into triplets, we can follow these steps:

1. Identify the Sequence

The original DNA sequence provided is: 5’ - CCGATACGCGGTATCCCGGGCTAATTGAA - 3’

2. Break into Triplets

We'll separate the sequence into groups of three nucleotides (triplets).

3. Write the Triplets

The triplets are as follows:

  • CCG
  • ATA
  • CGC
  • GGT
  • ATC
  • CCG
  • GGC
  • TAA
  • TTG
  • AA

4. Present the Triplets

We can represent the triplets with lines separating them:

5’ - CCG | ATA | CGC | GGT | ATC | CCG | GGC | TAA | TTG | AA - 3’

Final Answer

The triplets for the DNA sequence are: 5’ - CCG | ATA | CGC | GGT | ATC | CCG | GGC | TAA | TTG | AA - 3’

This problem has been solved

Upgrade your grade with Knowee

Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.